Skip to content
GET /v1/tm

Primer melting temperature

Try it live

10 free calls per day — no sign-up, no API key. Goes through the oanor gateway.

Custom headers (optional)
api.oanor.com/dnamelt-api

It works. Grab an API key and use it in your project.

Get an API key

Code snippets

curl "https://api.oanor.com/dnamelt-api/v1/tm" \
  -H "x-oanor-key: oanor_test_..."
await fetch("https://api.oanor.com/dnamelt-api/v1/tm", {
  headers: { "x-oanor-key": "oanor_test_..." }
});
$ch = curl_init("https://api.oanor.com/dnamelt-api/v1/tm");
curl_setopt($ch, CURLOPT_HTTPHEADER, ["x-oanor-key: oanor_test_..."]);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$out = curl_exec($ch);
import requests
requests.get(
    "https://api.oanor.com/dnamelt-api/v1/tm",
    headers={"x-oanor-key": "oanor_test_..."}
)

Example response

A real response from this endpoint, captured by the latest health check.

{
    "data": {
        "note": "Tm formulas: Wallace 2(A+T)+4(G+C) for ≤13 nt; Marmur–Wallace 64.9+41·(nGC−16.4)/N for longer; salt-adjusted adds 16.6·log10[Na+]. Annealing temperature is typically Tm − 5 °C.",
        "inputs": {
            "length": 20,
            "na_conc": 0.05,
            "sequence": "ATGCATGCATGCATGCATGC"
        },
        "method": "Marmur–Wallace (GC)",
        "tm_marmur": 51.78,
        "tm_wallace": 60,
        "recommended_tm": 51.78,
        "tm_salt_adjusted": 46.6529
    },
    "meta": {
        "timestamp": "2026-06-05T19:50:17.102Z",
        "request_id": "ef375235-b620-4a49-8b97-37ba17ce11aa"
    },
    "status": "ok",
    "message": "Melting temperature",
    "success": true
}