/v1/tm
Primer melting temperature
Try it live
10 free calls per day — no sign-up, no API key. Goes through the oanor gateway.
It works. Grab an API key and use it in your project.
Get an API keyCode snippets
curl "https://api.oanor.com/dnamelt-api/v1/tm" \ -H "x-oanor-key: oanor_test_..."
await fetch("https://api.oanor.com/dnamelt-api/v1/tm", {
headers: { "x-oanor-key": "oanor_test_..." }
});
$ch = curl_init("https://api.oanor.com/dnamelt-api/v1/tm");
curl_setopt($ch, CURLOPT_HTTPHEADER, ["x-oanor-key: oanor_test_..."]);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$out = curl_exec($ch);
import requests
requests.get(
"https://api.oanor.com/dnamelt-api/v1/tm",
headers={"x-oanor-key": "oanor_test_..."}
)
Example response
A real response from this endpoint, captured by the latest health check.
{
"data": {
"note": "Tm formulas: Wallace 2(A+T)+4(G+C) for ≤13 nt; Marmur–Wallace 64.9+41·(nGC−16.4)/N for longer; salt-adjusted adds 16.6·log10[Na+]. Annealing temperature is typically Tm − 5 °C.",
"inputs": {
"length": 20,
"na_conc": 0.05,
"sequence": "ATGCATGCATGCATGCATGC"
},
"method": "Marmur–Wallace (GC)",
"tm_marmur": 51.78,
"tm_wallace": 60,
"recommended_tm": 51.78,
"tm_salt_adjusted": 46.6529
},
"meta": {
"timestamp": "2026-06-05T19:50:17.102Z",
"request_id": "ef375235-b620-4a49-8b97-37ba17ce11aa"
},
"status": "ok",
"message": "Melting temperature",
"success": true
}