Skip to content
GET /v1/gc-content

GC content & molecular weight

Try it live

10 free calls per day — no sign-up, no API key. Goes through the oanor gateway.

Custom headers (optional)
api.oanor.com/dnamelt-api

It works. Grab an API key and use it in your project.

Get an API key

Code snippets

curl "https://api.oanor.com/dnamelt-api/v1/gc-content" \
  -H "x-oanor-key: oanor_test_..."
await fetch("https://api.oanor.com/dnamelt-api/v1/gc-content", {
  headers: { "x-oanor-key": "oanor_test_..." }
});
$ch = curl_init("https://api.oanor.com/dnamelt-api/v1/gc-content");
curl_setopt($ch, CURLOPT_HTTPHEADER, ["x-oanor-key: oanor_test_..."]);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$out = curl_exec($ch);
import requests
requests.get(
    "https://api.oanor.com/dnamelt-api/v1/gc-content",
    headers={"x-oanor-key": "oanor_test_..."}
)

Example response

A real response from this endpoint, captured by the latest health check.

{
    "data": {
        "note": "GC content = (G+C)/length. Molecular weight is for single-stranded DNA in g/mol. Higher GC means a more stable, higher-Tm duplex.",
        "inputs": {
            "length": 20,
            "sequence": "ATGCATGCATGCATGCATGC"
        },
        "at_count": 10,
        "gc_count": 10,
        "base_counts": {
            "A": 5,
            "C": 5,
            "G": 5,
            "T": 5
        },
        "molecular_weight": 6117.04,
        "at_content_percent": 50,
        "gc_content_percent": 50
    },
    "meta": {
        "timestamp": "2026-06-05T19:50:16.895Z",
        "request_id": "c058676e-ad2d-4fa1-bd07-2511b27ecfa8"
    },
    "status": "ok",
    "message": "GC content",
    "success": true
}