/v1/gc-content
GC content & molecular weight
Try it live
10 free calls per day — no sign-up, no API key. Goes through the oanor gateway.
It works. Grab an API key and use it in your project.
Get an API keyCode snippets
curl "https://api.oanor.com/dnamelt-api/v1/gc-content" \ -H "x-oanor-key: oanor_test_..."
await fetch("https://api.oanor.com/dnamelt-api/v1/gc-content", {
headers: { "x-oanor-key": "oanor_test_..." }
});
$ch = curl_init("https://api.oanor.com/dnamelt-api/v1/gc-content");
curl_setopt($ch, CURLOPT_HTTPHEADER, ["x-oanor-key: oanor_test_..."]);
curl_setopt($ch, CURLOPT_RETURNTRANSFER, true);
$out = curl_exec($ch);
import requests
requests.get(
"https://api.oanor.com/dnamelt-api/v1/gc-content",
headers={"x-oanor-key": "oanor_test_..."}
)
Example response
A real response from this endpoint, captured by the latest health check.
{
"data": {
"note": "GC content = (G+C)/length. Molecular weight is for single-stranded DNA in g/mol. Higher GC means a more stable, higher-Tm duplex.",
"inputs": {
"length": 20,
"sequence": "ATGCATGCATGCATGCATGC"
},
"at_count": 10,
"gc_count": 10,
"base_counts": {
"A": 5,
"C": 5,
"G": 5,
"T": 5
},
"molecular_weight": 6117.04,
"at_content_percent": 50,
"gc_content_percent": 50
},
"meta": {
"timestamp": "2026-06-05T19:50:16.895Z",
"request_id": "c058676e-ad2d-4fa1-bd07-2511b27ecfa8"
},
"status": "ok",
"message": "GC content",
"success": true
}