# UCSC Genome API > The UCSC Genome Browser as an API — reference genome data for hundreds of species, from the renowned UCSC Genome Browser at UC Santa Cruz. /v1/genomes lists the 220+ genome assemblies UCSC hosts, each with its assembly id (such as hg38 for human, mm39 for mouse, danRer11 for zebrafish), organism, description and data source. /v1/chromosomes?genome=hg38 returns an assembly's chromosomes and sequences with their sizes in base pairs, largest first. /v1/sequence?genome=hg38&chrom=chrM&start=0&end=100 retrieves the raw DNA sequence of any genomic region (0-based start, half-open end; regions are capped at 100,000 bases per call). Assembly ids come from /v1/genomes and chromosome names look like chr1, chrX or chrM. Ideal for bioinformatics pipelines, genome-visualisation and primer-design tools, region and sequence lookups, comparative genomics and teaching. Data from the UCSC Genome Browser (free for academic, non-profit and personal use). This is the genome browser's assemblies and raw reference sequence — distinct from gene-annotation and protein-sequence databases such as Ensembl, UniProt and ENA. ## Authentication All requests require your oanor API key in the `x-oanor-key` header. Get one at https://www.oanor.com/developer/keys. ```bash curl -H "x-oanor-key: oanor_live_…" "https://api.oanor.com/ucsc-api/..." ``` ## Pricing - **Free** (Free) — 2,300 calls/Mo, 2 req/s - **Starter** ($8/Mo) — 49,000 calls/Mo, 5 req/s - **Pro** ($23/Mo) — 220,000 calls/Mo, 12 req/s - **Mega** ($63/Mo) — 790,000 calls/Mo, 35 req/s ## Endpoints ### Genome #### `GET /v1/chromosomes` — An assembly chromosomes & sizes **Parameters:** - `genome` (query, required, string) — Assembly id, e.g. hg38 Example: `hg38` - `limit` (query, optional, string) — Max results (1-2000) **Example:** ```bash curl -H "x-oanor-key: $KEY" \ "https://api.oanor.com/ucsc-api/v1/chromosomes?genome=hg38" ``` **Response:** ```json { "data": { "count": 200, "total": 711, "genome": "hg38", "chromosomes": [ { "name": "chr1", "size_bp": 248956422 }, { "name": "chr2", "size_bp": 242193529 }, { "name": "chr3", "size_bp": 198295559 }, { "name": "chr4", "size_bp": 190214555 }, { "name": "chr5", "size_bp": 181538259 }, { "name": "chr6", "size_bp": 170805979 }, { "name": "chr7", "size_bp": 159345973 }, { "name": "chrX", "size_bp": 156040895 }, { "name": "chr8", "size_bp": 145138636 }, { "name": "chr9", "size_bp": 138394717 }, { "name": "chr11", "size_bp": 135086622 }, { "name": "chr10", "size_bp": 133797422 }, { "name": "chr12", "size_bp": 133275309 }, { "name": "chr13", "size_bp": 114364328 }, { …(truncated, see openapi.json for full schema) ``` #### `GET /v1/genomes` — List genome assemblies **Parameters:** - `limit` (query, optional, string) — Max results (1-1000) **Example:** ```bash curl -H "x-oanor-key: $KEY" \ "https://api.oanor.com/ucsc-api/v1/genomes" ``` **Response:** ```json { "data": { "count": 220, "genomes": [ { "id": "ailMel1", "source": "BGI-Shenzhen AilMel 1.0 Dec. 2009", "organism": "Panda", "common_name": "Ailuropoda melanoleuca", "description": "Dec. 2009 (BGI-Shenzhen 1.0/ailMel1)", "assembly_date": null }, { "id": "allMis1", "source": "International Crocodilian Genomes Working Group", "organism": "American alligator", "common_name": "Alligator mississippiensis", "description": "Aug. 2012 (allMis0.2/allMis1)", "assembly_date": null }, { "id": "anoCar1", "source": "Broad Institute AnoCar (1.0)", "organism": "Lizard", "common_name": "Anolis carolinensis", "description": "Feb. 2007 (Broad/anoCar1)", "assembly_date": null }, { "id": "anoCar2", "source": "Broad Institute of MIT and Harvard AnoCar 2.0 (GCA_000090745.1)", "organism": "Lizard", "common_name": "Anolis carolinensis", "description": "May 2010 (Broad AnoCar2.0/anoCar2)", "assembly_date": null }, { "id": "anoGam1", "source": "IAGEC v.MOZ2", …(truncated, see openapi.json for full schema) ``` #### `GET /v1/sequence` — DNA sequence of a region **Parameters:** - `genome` (query, required, string) — Assembly id, e.g. hg38 Example: `hg38` - `chrom` (query, required, string) — Chromosome, e.g. chrM Example: `chrM` - `start` (query, optional, string) — 0-based start Example: `0` - `end` (query, required, string) — Half-open end (<= start+100000) Example: `100` **Example:** ```bash curl -H "x-oanor-key: $KEY" \ "https://api.oanor.com/ucsc-api/v1/sequence?genome=hg38&chrom=chrM&start=0&end=100" ``` **Response:** ```json { "data": { "dna": "GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCATTTGGTATTTTCGTCTGGGGGGTATGCACGCGATAGCATTGCGAGACGCTG", "end": 100, "chrom": "chrM", "start": 0, "genome": "hg38", "length": 100 }, "meta": { "timestamp": "2026-06-01T16:23:32.297Z", "request_id": "c39822db-bf19-4916-acab-08924fe8d9d8" }, "status": "ok", "message": "Sequence retrieved", "success": true } ``` ### Meta #### `GET /v1/meta` — Usage notes **Example:** ```bash curl -H "x-oanor-key: $KEY" \ "https://api.oanor.com/ucsc-api/v1/meta" ``` **Response:** ```json { "data": { "note": "Reference genome data from the UCSC Genome Browser. /v1/genomes = the 220+ genome assemblies UCSC hosts — each with its assembly id (e.g. hg38 human, mm39 mouse, danRer11 zebrafish), organism, description and source; /v1/chromosomes?genome=hg38 = an assembly's chromosomes/sequences and their sizes in base pairs, largest first; /v1/sequence?genome=hg38&chrom=chrM&start=0&end=100 = the raw DNA sequence of a genomic region (0-based start, half-open end, region capped at 100,000 bases). Assembly ids come from /v1/genomes; chromosome names look like chr1, chrX, chrM. Data from UCSC (free for academic/non-profit/personal use). Distinct from gene-annotation/sequence databases (Ensembl, UniProt, ENA) — this is the genome browser's assemblies and raw reference sequence. Ideal for bioinformatics, genome-visualisation tools, primer/region lookups and education.", "source": "UCSC Genome Browser API (api.genome.ucsc.edu)", "endpoints": [ "/v1/genomes", "/v1/chromosomes", "/v1/sequence", "/v1/meta" ] }, "meta": { "timestamp": "2026-06-01T16:23:32.384Z", "request_id": "f5f76bde-dde7-42b6-890d-b10960078299" }, "status": "ok", "message": "Meta retrieved", "success": true } ``` --- Marketplace page: https://www.oanor.com/api/ucsc-api OpenAPI spec: https://www.oanor.com/api/ucsc-api/openapi.json